Biologia-Geologia.com
Biología y Geología 1º ESO Biología y Geología 3º ESO Biología y Geología 4º ESO Anatomía Aplicada 1º Bach
Biología 2º Bachillerato Geología 2º Bachillerato Blog "Profedebiogeo"

Saltar la navegación

10.6.1. El codigo genetico

El código genético

El código genético es el conjunto de reglas que permite la traducción de una secuencia de nucleótidos del ARNm a una secuencia de aminoácidos que constituye una proteína, en todos los seres vivos, lo que demuestra que ha tenido un origen único o universal, al menos en el contexto de nuestro planeta.

El código define la relación entre secuencias de tres nucleótidos, llamadas codones, y aminoácidos. De ese modo, cada codón se corresponde con un aminoácido específico.

La secuencia del material genético se compone de cuatro bases nitrogenadas distintas, que tienen una función equivalente a letras en el código genético: adenina (A), timina (T), guanina (G) y citosina (C) en el ADN y adenina (A), uracilo (U), guanina (G) y citosina (C) en el ARN.

La traducción del mensaje genético a proteínas se puede realizar gracias a este “diccionario” llamado código genético. Aunque sólo hay 20 aminoácidos distintos que codificar, sólo se disponen de 4 bases nitrogenadas distintas para hacerlo. Por tanto, hará falta más de una base nitrogenada para codificar cada aminoácido. Si fueran dos bases nitrogenadas, codificarían 42=16 parejas distintas de bases que codificarían 16 aminoácidos distintos. Y si fueran tres bases distintas (un triplete), codificarían, 43=64 tripletes distintos, lo que podría servir para codificar incluso a más de los 20 aminoácidos que existen.

Debido a esto, el número de codones posibles es 64:

  • 61 codones codifican aminoácidos (siendo además uno de ellos el codón de inicio, AUG, y que codifica el aminoácido metionina).
  • 3 codones que no codifican ningún aminoácido, pero son señales de parada (UAA, UAG, y UGA).

Cada triplete (grupo de tres) nucleótidos de ARNm se llama codón. La secuencia de codones determina la secuencia de aminoácidos en una proteína en concreto, que tendrá una estructura y una función específica. Los tripletes del ADN que han sido transcritos a esos codones, se llaman codógenos.

Características del código genético

El código genético tiene las siguientes características:

  • Es universal (o casi universal). El código genético es compartido por todos los organismos conocidos, incluidos los virus y orgánulos. Así, por ejemplo, el codón UUU codifica el aminoácido fenilalanina tanto en procariotas como en eucariotas. Esto indica que el código genético ha tenido un origen único en todos los seres vivos conocidos. La palabra "universal" se refiere solamente a la vida en la Tierra, ya que no se ha comprobado la existencia de vida en otro planeta. En mitocondrias y algunas bacterias el código varía levemente.

Aunque digamos que es universal, tiene algunas excepciones, como en las mitocondrias, protozoos y micoplasmas (un tipo de bacterias), cuyo código genético tiene alguna ligera diferencia.

  • El código genético está degenerado. Quiere decir que un aminoácido está codificado por más de un codón. Por ejemplo, aunque los codones GAA y GAG especifican el ácido glutámico (redundancia), ninguno especifica otro aminoácido (no existe ambigüedad). Todos aminoácidos, salvo la metionina y el triptófano, están codificados por más de un codón (codones sinónimos).

Esto puede ser una ventaja, ya que si por error se cambia un nucleótido, puede ser que no codifique otro aminoácido distinto y se genere otra proteína.

  • No es ambiguo, no presenta imperfección. No hay ambigüedad, ningún codón puede codificar más de un aminoácido, ya que si lo hiciera, sería un gran problema que un mismo gen codificase proteínas diferentes.
  • Es un código sin solapamientos. Los tripletes están dispuestos de manera lineal y continua, sin que entre ellos existan espacios y sin que compartan ninguna base nitrogenada. Su lectura se hace en un solo sentido (5´→3´), desde el codón de iniciación, que indica el comienzo de la proteína, hasta el codón de parada que indica su final. Sin embargo, un mismo ARNm puede tener varios codones de iniciación, lo que significa que se podrían sintetizar varios polipéptidos distintos a partir del mismo ARNm.

Traductor de Triplete de Bases Nitrogenadas

Selecciona las tres bases nitrogenadas en orden:

Resultado:

Cuestión de reflexión

Andalucía, Junio de 2019, opción A, cuestión 5

¿Qué característica tiene el código genético que permite a los investigadores introducir y expresar de forma correcta un gen de un organismo eucariota en uno procariota o viceversa? [1]. Razone la respuesta.

Actividad basada en Castilla y León, Julio de 2023, pregunta 4

Si la hebra codificante (o informativa) de un oligonucleótido es:

5´-ATG AGC CGA ATG TAA-3´…

a) Escriba la secuencia de la hebra molde de ADN y del ARNm. (0,8)
b) Utilizando la tabla con el código genético de la derecha, escriba la secuencia del oligopéptido codificado por el siguiente ARNm:

5´-AGC-AUG-UUA-UAC-3´.

Defina qué es una mutación puntual o génica e indique una de sus consecuencias. (0,8)
c) ¿Por qué el código genético es degenerado? Razone la respuesta. (0,4)

a) Escriba la secuencia de la hebra molde de ADN y del ARNm.

Si la hebra codificante (o informativa) de un oligonucleótido es:

5´-ATG AGC CGA ATG TAA-3´…

La secuencia ADN molde será

- - - - - -

y la secuencia de ARNm será

- - - - - - .


b) Utilizando la tabla con el código genético, escriba la secuencia del oligopéptido codificado por el siguiente ARNm:

5´-AGC-AUG-UUA-UAC-3´.

- - -

Habilitar JavaScript

Preguntas que han salido en exámenes de acceso a la Universidad (Selectividad, EBAU, EvAU)

Aragón, Septiembre de 2019, opción B, cuestión 3.

A continuación, se muestra una cadena polipeptídica cuya secuencia es:

NH2 - Met - Cys - Glu - Trp - His - Phe - COOH

Usando el cuadro adjunto que contiene el código genético, responda. (2,5 puntos)

a) Indique una posible secuencia de ARNm que se traduzca en este polipéptido, así como su polaridad. (0,5 puntos)

b) Indique la secuencia de bases de ADN que codificaría el ARNm del apartado anterior. (0,5 puntos)

c) Señale una posible mutación de la secuencia de ADN que cambiaría el aminoácido His por Pro. ¿Qué tipo de mutación sería? (0,5 puntos)

d) ¿Dicha mutación se transmitirá a la descendencia? Razone la respuesta. (0,5 puntos)

e) Explique dos características del código genético. (0,5 puntos)

Aragón. Septiembre de 2018, Opción B, cuestión 1.

Suponga una cadena de ADN cuya secuencia es: (2,5 puntos)

                        3’ … TCTGGACCT ….5’

d) ¿Qué se entiende por código genético? (0,5 puntos)

Andalucía, Septiembre de 2018, opción A, cuestión 3.

a) Explique qué se entiende por código genético [0,6].

b) Defina los términos codón y anticodón [0,5].

c) ¿Qué son los codones sin sentido o de terminación? [0,4]

d) Describa dos características del código genético [0,5].

Aragón. Junio de 2009, opción A. 4. (2 puntos):

a) ¿Qué son las mutaciones?

b) Ejemplo de cada uno de los tipos que conozca.

c) ¿Qué significado biológico tienen?

d) ¿Es posible que un cambio de una sola base de un gen de lugar a la misma proteína?

e) ¿Es posible que el cambio de una sola base origine una proteína idéntica, pero mucho más corta?

f) ¿Un cambio de una base puede dar lugar a una proteína totalmente distinta?

Aragón. Junio de 2017, opción A. Cuestión 1

Explique brevemente: (2,5 puntos)

a) Código genético. (0,5 puntos)

Aragón. Septiembre de 2008, opción B. Cuestión 4. (1 punto). Septiembre de 2003, opción A. Cuestión 3. Junio de 2002, opción B, parte A. Cuestión 2.

Justifique el hecho de que genes con secuencias no idénticas de DNA puedan codificar la misma proteína.

Aragón. Septiembre de 2008, opción A. Cuestión 1Septiembre de 2001, opción B. Cuestión 1.

Tema de desarrollo corto (3 puntos). El código genético: explique qué es y cuáles son sus reglas o características.

País Vasco, Junio de 2017, opción A, cuestión 1.

Transcripción del ADN y código genético.

a) Explica en qué consiste la transcripción del ADN. Acompáñate de unos esquemas para ello (1 punto)

b) Explica brevemente qué es el código genético; ¿a qué se refiere cuando se dice que el código genético es universal? ¿y cuando se dice que está degenerado? (1 punto)

Andalucía, Junio de 2019, opción A, cuestión 5.

¿Qué característica tiene el código genético que permite a los investigadores introducir y expresar de forma correcta un gen de un organismo eucariota en uno procariota o viceversa? [1]. Razone la respuesta.

Canarias, Julio de 2020, pregunta 8

La técnica Edición Principal (creada en la Univ. Harvard, USA), permite editar el código genético de los seres humanos con mayor precisión que ninguna otra hasta ahora.

a.- ¿Qué es un codón?
b.- ¿Qué es un anticodón?
c.- ¿En qué macromolécula podemos encontrar los codones?
d.- ¿En qué macromolécula podemos encontrar los anticodones?

Castilla La Mancha, Julio de 2020, bloque 2.2.

En abril del pasado año falleció el carismático premio Nobel de Medicina Sydney Brenner, pionero en el desciframiento del código genético, quien acuñó el término “codón”.

a. ¿Qué es un “codón”?

b. ¿Qué es el código genético?

c. ¿Qué indica el término “degenerado” aplicado al código genético?

Galicia, Julio de 2020, pregunta 6

Empleando la tabla con el código genético:

a) Determine la secuencia de las dos hebras del fragmento de ADN del que proviene este ARNm (5’…UUC GCC AAU GUA ACC AAA ACU CCU CGG…3’) y la correspondiente secuencia de aminoácidos que se origina en la traducción (indicando las polaridades en ambos casos).

b) El ARNm del apartado anterior codifica un fragmento de un polipéptido. En una célula, aparece una variante de este fragmento polipeptídico que contiene Lisina en la posición 3ª de la secuencia. Escriba las posibles secuencias de bases del ADN que pudieron originar la nueva variante ¿Qué tipo de mutación pudo provocar la modificación? (2 puntos)

Murcia, Julio de 2020, pregunta 4.1

4.1. Sobre el código genético:

a) ¿Cuáles son características? (0,5 puntos)
b) ¿Qué significado tiene que sea degenerado pero que no sea ambiguo? (0,5 puntos)

País Vasco, Julio de 2020, opción 1B

El 7 de noviembre de 2010 falleció Margarita Salas. Esta investigadora realizó importantes aportaciones con relación a las cuestiones que se tratan a continuación:

a) (0,5 puntos) Si la secuencia de bases de nucleótidos de una hebra es:

3´.....ATTCAGGATGACAGTATG...5´

Escribe la secuencia de bases de la hebra de ADN complementaria.

b) (0,5 puntos) Escribe la secuencia de bases del ARN-m correspondiente a la hebra de ADN anterior.

c) (0,5 puntos) ¿Qué relación tiene el código genético con la síntesis de proteínas?

d) (1 punto) ¿Qué se entiende por replicación semiconservativa? Explícalo ayudándote de un esquema.

Aragón, Junio de 2021, pregunta 3

3.- Responda las siguientes cuestiones: (2 puntos)

a) Escriba la secuencia de ARNm que se transcribiría de la siguiente cadena hebra de una molécula de ADN bicatenario: (0,2 p)

3’…TACAAGTACTTGTTTCTTATT…5’

b) Escriba la secuencia de aminoácidos que resultaría de la traducción. (0,6 p)
c) Suponga que las dos G se cambian por A, ¿cómo afectarían estas mutaciones a la secuencia de aminoácidos? ¿cómo lo explicaría? ¿qué tipo de mutación sería? (0,6 p)
d) Y si se eliminan las G, ¿cómo afectaría en este caso y qué tipo de mutación sería? (0,6 p)

Cantabria, Junio de 2021, pregunta 13

Pregunta 13 [1,25 PUNTOS]

El código genético, concepto y características generales. ¿Por qué razón se considera que la naturaleza del código genético minimiza el efecto fenotípico de algunas mutaciones? Ponga un ejemplo.

Galicia, Junio de 2021, pregunta 5

Pregunta 5. GENÉTICA Y EVOLUCIÓN. 

5.1. De la siguiente secuencia de nucleótidos: 
CGA CCC CTC ATA GGC AAA CAC CGC TAT ATC , contesta a las siguientes preguntas:

a) ¿A qué molécula pertenecerá, ADN o ARN? Justifica tu respuesta. 

b) Cuál será la secuencia de aminoácidos  ¿Qué se puede obtener de esta secuencia de nucleótidos? Usar el código genético (ver en otra parte de la página) para obtener la secuencia de aminoácidos. 

c) Señala dos características del código genético y  explíquelas brevemente. 

La Rioja, Junio de 2021, pregunta 14

Concepto y características del código genético. Esquematice el proceso de traducción.

Navarra, Junio de 2021, pregunta 12

¿El cambio por una mutación de un par de bases en un gen de DNA que codifique para una proteína conlleva siempre un cambio en esa proteína? Razona tu respuesta.

Comunidad Valenciana, Junio de 2021, pregunta 6.1

a) Explica brevemente qué es el código genético. Explica dos de sus características fundamentales (3 puntos).
b) Clasifica las siguientes situaciones por el tipo de mutación que provocan:

1. Se pierde un fragmento del DNA,

2. Se duplica un fragmento del DNA,

3. Se pierde un cromosoma,

4. Se desamina alguna citosina en la cadena del DNA (2 puntos).

Asturias, Julio de 2021, pregunta 3B

En el laboratorio se ha aislado el ADN de una bacteria que contiene la información para la síntesis de la proteína P2019 que actúa como antibiótico.

a. ¿Podemos utilizar el mismo código genético que en humanos para traducir la proteína y obtener el antibiótico? Razone la respuesta. (Calificación máxima 0,5 puntos)
b. Si conocemos la secuencia de aminoácidos de la proteína P2019, ¿podemos saber exactamente la secuencia de nucleótidos del ADN que la codifica? Razone la respuesta. (Calificación máxima 0,25 puntos)
c. La proteína aislada se une a la proteína L15 que forma parte del centro activo de la ribozima peptidil transferasa de la subunidad grande del ribosoma 70S bloqueando dicha proteína. ¿Qué consecuencias tendría esto para la bacteria? (Calificación máxima 1,25 puntos)

Asturias, Junio de 2022, pregunta 6

Anne Rudloe fue una bióloga marina estadounidense cofundadora del Laboratorio de Especies Marinas de Florida que dedicó parte de su investigación al cangrejo cacerola (Limulus polyphemus), un artrópodo clasificado como “fósil viviente” que tiene sangre o hemolinfa de color azul debido a un pigmento llamado hemocianina que contiene amebocitos que detectan la presencia de endotoxinas producidas por bacterias patógenas, por lo que es utilizada por la industria farmaceútica para la obtención de vacunas, medicamentos inyectables o prótesis.

a. Si en el ADN del cangrejo cacerola el 18% de las bases nitrogenadas son citosinas, ¿qué porcentaje de las otras bases posee? Razona la respuesta. (Calificación máxima 0,5 puntos)

b. ¿Cuándo en un ARN-m se sustituye una Adenina por una Citosina, es eso una mutación? Justifica tu respuesta. (Calificación máxima 0,5 puntos)

c. ¿Qué es una horquilla de replicación? (Calificación máxima 0,5 puntos)

d. ¿Es posible alterar la secuencia de bases de un gen sin que se altere la proteína? Razona la respuesta. (Calificación máxima 0,5 puntos)

Aragón, Julio de 2022, pregunta 10

A finales de los años 90, el alcalde de una pequeña localidad solicitó a los vecinos de dicho municipio que, de manera voluntaria, entregaran una muestra de ADN para resolver un crimen que se había cometido. Años más tarde, cuando se resolvió el caso, un conocido periódico recogió la noticia diciendo que “[…] mediante esta recogida de muestras se pretendía comprobar si el código genético de alguno de los vecinos coincidía con el del culpable”. (2 puntos)

a) ¿Qué es el código genético? (0,75 puntos). Explique dos características del código genético. (0,5 puntos)
b) La frase entrecomillada del enunciado es incorrecta. ¿Cuál es el error? ¿Qué debería haber escrito el periodista? Explíquelo brevemente. (0,75 puntos)

Canarias, Julio de 2022, pregunta 15

El color de los ojos depende de la pigmentación del iris. Un equipo internacional de investigadores ha identificado 50 genes nuevos para el color de ojos en humanos. (Fuente: //advances.sciencemag.org/)

a. ¿Qué es un gen?
b. ¿Cómo se denomina el proceso de expresión genética?
c. Salvo algunas excepciones, los organismos comparten el mismo código genético, qué relación de correspondencia se establece en este código?
d. Indica la dotación cromosómica de la especie humana, especificando cuántos son autosomas.

Murcia, Julio de 2022, pregunta 4.1.

Explique brevemente las características del código genético (1 punto).

País Vasco, Junio de 2023, opción 3B

En 2018 tuvo lugar un atraco en una sucursal de una conocida entidad bancaria de la comunidad autónoma, en el que los atracadores se llevaron un botín de dos millones. La Ertzaintza solicitó a los usuarios que estaban presentes en el momento del robo que, de manera voluntaria, entregaran una muestra de ADN para tratar de resolver la autoría del robo. Un año después, cuando se resolvió el caso, un conocido periódico publicó la noticia diciendo que “[…] mediante esta recogida de muestras se pretendía comprobar si el código genético de alguno de los clientes del banco presentes en el momento del atraco coincidía con el del culpable”.

a) ¿Qué es el código genético? (0,75 p)
b) Explique dos características del código genético (1,0 p)
c) La frase entrecomillada del enunciado es incorrecta. ¿Cuál es el error? ¿Qué debería haber escrito el periodista? Explíquelo brevemente (0,75 p)

Cantabria, Julio de 2023, pregunta 12

Escriba la secuencia de la molécula de ARNm que resulta de la transcripción del siguiente fragmento de ADN, 5’-ATGAACAGGCCATGA-3’, y la secuencia de aminoácidos resultante de la traducción de dicho ARNm. Use la información de la figura 4 (ver una tabla con el código genético). ¿Cuántas mutaciones silenciosas podrían producirse en ese fragmento de ADN?

Ideas básicas sobre el código genético

El código genético

El código genético tiene estas características:

  • Es universal. Todos los seres conocidos comparten el mismo código genético.
  • Está degenerado, Un mismo aminoácido está codificado por más de un codón.
  • No presenta imperfección. El código genético no es ambiguo, un codón no puede codificar más de un aminoácido.
  • Sin solapamientos. Los tripletes están dispuestos de forma lineal y continua y se leen en sentido 5´→3´.

Repasando el código genético

Pregunta

¿Qué bases nitrogenadas componen la secuencia del material genético en el ADN?

Respuestas

Adenina, Uracilo, Guanina, Citosina.

Adenina, Timina, Guanina, Citosina.

Uracilo, Timina, Adenina, Citosina.

Timina, Guanina, Adenina, Uracilo.

Retroalimentación

Pregunta

¿Cuántos codones posibles existen en el código genético?

Respuestas

20.

42.

64.

61.

Retroalimentación

Pregunta

¿Cuál es la función de los codones de parada en el código genético?

Respuestas

Codificar aminoácidos.

Iniciar la síntesis de proteínas.

Detener la traducción.

Sintetizar ARNm.

Retroalimentación

Pregunta

¿Cómo se llama el grupo de tres nucleótidos de ARNm?

Respuestas

Aminoácido.

Codógeno.

Codón.

Anticodón.

Retroalimentación

Pregunta

¿Qué indica la degeneración del código genético?

Respuestas

Ambigüedad en la traducción.

Más de un codón para un aminoácido.

Un solo codón para cada aminoácido.

Solapamiento de tripletes.

Retroalimentación

Pregunta

¿Cuál es la ventaja de que el código genético sea degenerado?

Respuestas

Aumenta la ambigüedad.

Limita la síntesis de proteínas.

Permite la corrección de errores.

Genera solapamientos.

Retroalimentación

Pregunta

¿Qué función tienen los codones UAA, UAG y UGA en el código genético?

Respuestas

Codifican aminoácidos.

Son señales de parada.

Inician la traducción.

Son codones especiales.

Retroalimentación

Pregunta

¿Qué es un codógeno?

Respuestas

Un aminoácido codificado.

Un codón especial.

Un triplete del ADN transcritos a codones de ARNm.

Una base nitrogenada.

Retroalimentación

Actividad basada en Cataluña, Junio de 1998, opción A, ejercicio 2A.

En 1909, W. Johannsen propuso el término gen ("el que da origen a") para designar los factores de la herencia descubiertos por Mendel. Posteriormente, varias investigaciones condujeron a la idea de que los genes controlan la estructura de las proteínas.

a) En la tabla siguiente aparece un fragmento de gen. Completela, utilizando la tabla del código genético que se adjunta. (1 punto)

Cadena de DNA que se transcribe C -  - -  -  -  A C T
mRNA - C A -  -  - U  -  -
tRNA -  -  -  -  -  -  -  -  - 
Aminoácido incorporado a la proteína - Trp -

b) Si sometemos un DNA bicatenario a temperaturas próximas a 100ºC, se desnaturaliza. ¿Qué quiere decir esto? Menciona otras biomoléculas que también se desnaturalicen. (1 punto)

c) El 15% de las bases nitrogenadas del ácido nucleico de un virus determinado, es adenina. Haz una tabla donde se indique cuál será la composición de las otras bases nitrogenadas si se trata de un fragmento de DNA bicatenario o de un fragmento de RNA bicatenario. ¿Se podría determinar el porcentaje de cada una de las bases en el caso de un RNA monocatenario? Justificándolo brevemente en cada caso. (1 punto)

a) En la tabla siguiente aparece un fragmento de gen. Completela, utilizando la tabla del código genético que se adjunta (ver la de otro ejercicio). (1 punto)

Cadena de DNA que se transcribe           A  C  T
mRNA   C  A     U  G  A
tRNA            
Aminoácido incorporado a la proteína Trp

b) Si sometemos un DNA bicatenario a temperaturas próximas a 100ºC, se desnaturaliza. ¿Qué quiere decir esto? Menciona otras biomoléculas que también se desnaturalicen. (1 punto)

Cuando el ADN se desnaturaliza, significa que los enlaces de hidrógeno entre las bases nitrogenadas que conectan sus dos cadenas se rompen, lo que resulta en la separación de las dos cadenas del ADN bicatenario. Es importante destacar que durante este proceso no se rompe ningún enlace fosfodiéster, como los que unen los nucleótidos dentro de cada cadena.

Del mismo modo, las proteínas pueden desnaturalizarse al perder su estructura tridimensional, pero sin que se produzca una ruptura de enlaces peptídicos. Por lo tanto, la estructura primaria de las proteínas permanece intacta. La desnaturalización puede ser provocada por diversos factores, como el aumento de la temperatura (las proteínas suelen comenzar a desnaturalizarse a partir de aproximadamente 40°C), cambios en el pH o en la concentración de iones en el medio.

La pérdida de la estructura tridimensional implica una alteración en la conformación de las moléculas, pero no una ruptura de los enlaces covalentes que mantienen unidas las unidades fundamentales de estas macromoléculas.

c) El 15% de las bases nitrogenadas del ácido nucleico de un virus determinado, es adenina. Haz una tabla donde se indique cuál será la composición de las otras bases nitrogenadas si se trata de un fragmento de DNA bicatenario o de un fragmento de RNA bicatenario. ¿Se podría determinar el porcentaje de cada una de las bases en el caso de un RNA monocatenario? Justificándolo brevemente en cada caso. (1 punto)

Según el principio de complementariedad de bases, en los ácidos nucleicos bicatenarios habrá la misma cantidad de Adenina (o Uracilo el ARN) que Timina y de Citosita que de Guanina. 
 

Tipo de ácido nucleico  Adenina   Timina   Guanina   Citosina     Uracil 
a)
DNA bicatenario
15%
b)
RNA bicatenario
15%

En un ARN monocatenario, no se cumple el principio de la complementariedad de bases tal como ocurre en el ADN. Esto se debe a que la secuencia de bases en la cadena es flexible y no está predeterminada por una cadena complementaria. Por lo tanto, lo máximo que podemos inferir es que aproximadamente un 85% de las bases presentes serán adenina, guanina y citosina.
 

Habilitar JavaScript

Creado con eXeLearning (Ventana nueva)