BIOLOGÍA - GEOLOGÍA . COM

1º ESO

3º ESO

4º ESO

Biología 2º Bach.

Adaptaciones curriculares

Foros

 

Saltar la navegación

10.6.1. El código genetico

El código genético

El código genético es el conjunto de reglas que permite la traducción de una secuencia de nucleótidos del ARNm a una secuencia de aminoácidos que constituye una proteína, en todos los seres vivos, lo que demuestra que ha tenido un origen único o universal, al menos en el contexto de nuestro planeta.

El código define la relación entre secuencias de tres nucleótidos, llamadas codones, y aminoácidos. De ese modo, cada codón se corresponde con un aminoácido específico.

La secuencia del material genético se compone de cuatro bases nitrogenadas distintas, que tienen una función equivalente a letras en el código genético: adenina (A), timina (T), guanina (G) y citosina (C) en el ADN y adenina (A), uracilo (U), guanina (G) y citosina (C) en el ARN.

La traducción del mensaje genético a proteínas se puede realizar gracias a este “diccionario” llamado código genético. Aunque sólo hay 20 aminoácidos distintos que codificar, sólo se disponen de 4 bases nitrogenadas distintas para hacerlo. Por tanto, hará falta más de una base nitrogenada para codificar cada aminoácido. Si fueran dos bases nitrogenadas, codificarían 42=16 parejas distintas de bases que codificarían 16 aminoácidos distintos. Y si fueran tres bases distintas (un triplete), codificarían, 43=64 tripletes distintos, lo que podría servir para codificar incluso a más de los 20 aminoácidos que existen.

Debido a esto, el número de codones posibles es 64:

  • 61 codones codifican aminoácidos (siendo además uno de ellos el codón de inicio, AUG, y que codifica el aminoácido metionina).
  • 3 codones que no codifican ningún aminoácido, pero son señales de parada (UAA, UAG, y UGA).

Cada triplete (grupo de tres) nucleótidos de ARNm se llama codón. La secuencia de codones determina la secuencia de aminoácidos en una proteína en concreto, que tendrá una estructura y una función específica. Los tripletes del ADN que han sido transcritos a esos codones, se llaman codógenos.

Características del código genético

El código genético tiene las siguientes características:

  • Es universal. El código genético es compartido por todos los organismos conocidos, incluidos los virus y orgánulos. Así, por ejemplo, el codón UUU codifica el aminoácido fenilalanina tanto en procariotas como en eucariotas. Esto indica que el código genético ha tenido un origen único en todos los seres vivos conocidos. La palabra "universal" se refiere solamente a la vida en la Tierra, ya que no se ha comprobado la existencia de vida en otro planeta.

Aunque digamos que es universal, tiene algunas excepciones, como en las mitocondrias, protozoos y micoplasmas (un tipo de bacterias), cuyo código genético tiene alguna ligera diferencia.

  • El código genético está degenerado. Quiere decir que un aminoácido está codificado por más de un codón. Por ejemplo, aunque los codones GAA y GAG especifican el ácido glutámico (redundancia), ninguno especifica otro aminoácido (no existe ambigüedad). Todos aminoácidos, salvo la metionina y el triptófano, están codificados por más de un codón (codones sinónimos).

Esto puede ser una ventaja, ya que si por error se cambia un nucleótido, puede ser que no codifique otro aminoácido distinto y se genere otra proteína.

  • No presenta imperfección. No hay ambigüedad, ningún codón puede codificar más de un aminoácido, ya que si lo hiciera, sería un gran problema que un mismo gen codificase proteínas diferentes.
  • Es un código sin solapamientos. Los tripletes están dispuestos de manera lineal y continua, sin que entre ellos existan espacios y sin que compartan ninguna base nitrogenada. Su lectura se hace en un solo sentido (5´→3´), desde el codón de iniciación, que indica el comienzo de la proteína, hasta el codón de parada que indica su final. Sin embargo, un mismo ARNm puede tener varios codones de iniciación, lo que significa que se podrían sintetizar varios polipéptidos distintos a partir del mismo ARNm.

Cuestión de reflexión

Andalucía, Junio de 2019, opción A, cuestión 5

¿Qué característica tiene el código genético que permite a los investigadores introducir y expresar de forma correcta un gen de un organismo eucariota en uno procariota o viceversa? [1]. Razone la respuesta.

Preguntas que han salido en exámenes de acceso a la Universidad (Selectividad, EBAU, EvAU)

Aragón, Septiembre de 2019, opción B, cuestión 3.

A continuación, se muestra una cadena polipeptídica cuya secuencia es:

NH2 - Met - Cys - Glu - Trp - His - Phe - COOH

Usando el cuadro adjunto que contiene el código genético, responda. (2,5 puntos)

a) Indique una posible secuencia de ARNm que se traduzca en este polipéptido, así como su polaridad. (0,5 puntos)

b) Indique la secuencia de bases de ADN que codificaría el ARNm del apartado anterior. (0,5 puntos)

c) Señale una posible mutación de la secuencia de ADN que cambiaría el aminoácido His por Pro. ¿Qué tipo de mutación sería? (0,5 puntos)

d) ¿Dicha mutación se transmitirá a la descendencia? Razone la respuesta. (0,5 puntos)

e) Explique dos características del código genético. (0,5 puntos)

Aragón. Septiembre de 2018, Opción B, cuestión 1.

Suponga una cadena de ADN cuya secuencia es: (2,5 puntos)

                        3’ … TCTGGACCT ….5’

d) ¿Qué se entiende por código genético? (0,5 puntos)

Andalucía, Septiembre de 2018, opción A, cuestión 3.

a) Explique qué se entiende por código genético [0,6].

b) Defina los términos codón y anticodón [0,5].

c) ¿Qué son los codones sin sentido o de terminación? [0,4]

d) Describa dos características del código genético [0,5].

Aragón. Junio de 2009, opción A. 4. (2 puntos):

a) ¿Qué son las mutaciones?

b) Ejemplo de cada uno de los tipos que conozca.

c) ¿Qué significado biológico tienen?

d) ¿Es posible que un cambio de una sola base de un gen de lugar a la misma proteína?

e) ¿Es posible que el cambio de una sola base origine una proteína idéntica, pero mucho más corta?

f) ¿Un cambio de una base puede dar lugar a una proteína totalmente distinta?

Aragón. Junio de 2017, opción A. Cuestión 1

Explique brevemente: (2,5 puntos)

a) Código genético. (0,5 puntos)

Aragón. Septiembre de 2008, opción B. Cuestión 4. (1 punto). Septiembre de 2003, opción A. Cuestión 3. Junio de 2002, opción B, parte A. Cuestión 2.

Justifique el hecho de que genes con secuencias no idénticas de DNA puedan codificar la misma proteína.

Aragón. Septiembre de 2008, opción A. Cuestión 1Septiembre de 2001, opción B. Cuestión 1.

Tema de desarrollo corto (3 puntos). El código genético: explique qué es y cuáles son sus reglas o características.

País Vasco, Junio de 2017, opción A, cuestión 1.

Transcripción del ADN y código genético.

a) Explica en qué consiste la transcripción del ADN. Acompáñate de unos esquemas para ello (1 punto)

b) Explica brevemente qué es el código genético; ¿a qué se refiere cuando se dice que el código genético es universal? ¿y cuando se dice que está degenerado? (1 punto)

Andalucía, Junio de 2019, opción A, cuestión 5.

¿Qué característica tiene el código genético que permite a los investigadores introducir y expresar de forma correcta un gen de un organismo eucariota en uno procariota o viceversa? [1]. Razone la respuesta.

Canarias, Julio de 2020, pregunta 8

La técnica Edición Principal (creada en la Univ. Harvard, USA), permite editar el código genético de los seres humanos con mayor precisión que ninguna otra hasta ahora.

a.- ¿Qué es un codón?
b.- ¿Qué es un anticodón?
c.- ¿En qué macromolécula podemos encontrar los codones?
d.- ¿En qué macromolécula podemos encontrar los anticodones?

Castilla La Mancha, Julio de 2020, bloque 2.2.

En abril del pasado año falleció el carismático premio Nobel de Medicina Sydney Brenner, pionero en el desciframiento del código genético, quien acuñó el término “codón”.

a. ¿Qué es un “codón”?

b. ¿Qué es el código genético?

c. ¿Qué indica el término “degenerado” aplicado al código genético?

Galicia, Julio de 2020, pregunta 6

Empleando la tabla con el código genético:

a) Determine la secuencia de las dos hebras del fragmento de ADN del que proviene este ARNm (5’…UUC GCC AAU GUA ACC AAA ACU CCU CGG…3’) y la correspondiente secuencia de aminoácidos que se origina en la traducción (indicando las polaridades en ambos casos).

b) El ARNm del apartado anterior codifica un fragmento de un polipéptido. En una célula, aparece una variante de este fragmento polipeptídico que contiene Lisina en la posición 3ª de la secuencia. Escriba las posibles secuencias de bases del ADN que pudieron originar la nueva variante ¿Qué tipo de mutación pudo provocar la modificación? (2 puntos)

Murcia, Julio de 2020, pregunta 4.1

4.1. Sobre el código genético:

a) ¿Cuáles son características? (0,5 puntos)
b) ¿Qué significado tiene que sea degenerado pero que no sea ambiguo? (0,5 puntos)

País Vasco, Julio de 2020, opción 1B

El 7 de noviembre de 2010 falleció Margarita Salas. Esta investigadora realizó importantes aportaciones con relación a las cuestiones que se tratan a continuación:

a) (0,5 puntos) Si la secuencia de bases de nucleótidos de una hebra es:

3´.....ATTCAGGATGACAGTATG...5´

Escribe la secuencia de bases de la hebra de ADN complementaria.

b) (0,5 puntos) Escribe la secuencia de bases del ARN-m correspondiente a la hebra de ADN anterior.

c) (0,5 puntos) ¿Qué relación tiene el código genético con la síntesis de proteínas?

d) (1 punto) ¿Qué se entiende por replicación semiconservativa? Explícalo ayudándote de un esquema.

Aragón, Junio de 2021, pregunta 3

3.- Responda las siguientes cuestiones: (2 puntos)

a) Escriba la secuencia de ARNm que se transcribiría de la siguiente cadena hebra de una molécula de ADN bicatenario: (0,2 p)

3’…TACAAGTACTTGTTTCTTATT…5’

b) Escriba la secuencia de aminoácidos que resultaría de la traducción. (0,6 p)
c) Suponga que las dos G se cambian por A, ¿cómo afectarían estas mutaciones a la secuencia de aminoácidos? ¿cómo lo explicaría? ¿qué tipo de mutación sería? (0,6 p)
d) Y si se eliminan las G, ¿cómo afectaría en este caso y qué tipo de mutación sería? (0,6 p)

Cantabria, Junio de 2021, pregunta 13

Pregunta 13 [1,25 PUNTOS]

El código genético, concepto y características generales. ¿Por qué razón se considera que la naturaleza del código genético minimiza el efecto fenotípico de algunas mutaciones? Ponga un ejemplo.

Galicia, Junio de 2021, pregunta 5

Pregunta 5. GENÉTICA Y EVOLUCIÓN. 

5.1. De la siguiente secuencia de nucleótidos: 
CGA CCC CTC ATA GGC AAA CAC CGC TAT ATC , contesta a las siguientes preguntas:

a) ¿A qué molécula pertenecerá, ADN o ARN? Justifica tu respuesta. 

b) Cuál será la secuencia de aminoácidos  ¿Qué se puede obtener de esta secuencia de nucleótidos? Usar el código genético (ver en otra parte de la página) para obtener la secuencia de aminoácidos. 

c) Señala dos características del código genético y  explíquelas brevemente. 

La Rioja, Junio de 2021, pregunta 14

Concepto y características del código genético. Esquematice el proceso de traducción.

Navarra, Junio de 2021, pregunta 12

¿El cambio por una mutación de un par de bases en un gen de DNA que codifique para una proteína conlleva siempre un cambio en esa proteína? Razona tu respuesta.

Comunidad Valenciana, Junio de 2021, pregunta 6.1

a) Explica brevemente qué es el código genético. Explica dos de sus características fundamentales (3 puntos).
b) Clasifica las siguientes situaciones por el tipo de mutación que provocan:

1. Se pierde un fragmento del DNA,

2. Se duplica un fragmento del DNA,

3. Se pierde un cromosoma,

4. Se desamina alguna citosina en la cadena del DNA (2 puntos).

Asturias, Julio de 2021, pregunta 3B

En el laboratorio se ha aislado el ADN de una bacteria que contiene la información para la síntesis de la proteína P2019 que actúa como antibiótico.

a. ¿Podemos utilizar el mismo código genético que en humanos para traducir la proteína y obtener el antibiótico? Razone la respuesta. (Calificación máxima 0,5 puntos)
b. Si conocemos la secuencia de aminoácidos de la proteína P2019, ¿podemos saber exactamente la secuencia de nucleótidos del ADN que la codifica? Razone la respuesta. (Calificación máxima 0,25 puntos)
c. La proteína aislada se une a la proteína L15 que forma parte del centro activo de la ribozima peptidil transferasa de la subunidad grande del ribosoma 70S bloqueando dicha proteína. ¿Qué consecuencias tendría esto para la bacteria? (Calificación máxima 1,25 puntos)

Ideas básicas sobre el código genético

El código genético

El código genético tiene estas características:

  • Es universal. Todos los seres conocidos comparten el mismo código genético.
  • Está degenerado, Un mismo aminoácido está codificado por más de un codón.
  • No presenta imperfección. El código genético no es ambiguo, un codón no puede codificar más de un aminoácido.
  • Sin solapamientos. Los tripletes están dispuestos de forma lineal y continua y se leen en sentido 5´→3´.
Biología y Geología 2º de Bachillerato. Puedes comentar y aportar lo que consideres en nuestro foro.

 

Currículos de Biología y Geología

Blog

Descargas

Contacto

Sorpresas en exámenes

Índice global

Aviso legal

Síguenos si te ha sido útil biologia-geologia.com.
 

Materiales didácticos de Biología y Geología para el alumnado de Enseñanza Secundaria Obligatoria (ESO) y Bachillerato.